Индексировано в
  • Open J Gate
  • Журнал GenamicsSeek
  • CiteFactor
  • RefSeek
  • Университет Хамдарда
  • ЭБСКО АЗ
  • NSD - Норвежский центр исследовательских данных
  • OCLC- WorldCat
  • Паблоны
  • Женевский фонд медицинского образования и исследований
  • Евро Паб
  • Google Scholar
Поделиться этой страницей
Флаер журнала
Flyer image

Абстрактный

Impairment of Nanog3 Stem Cell Dysregulation Associate with Male Infertility in Human

Saxena AK and Rastogi A

Stem cells have capacity to differentiate into a variety of cell types. The inner cell mass of epiblast and primordial germ cells (PGCs) are pluripotent in nature. Nanog3 has been identified as a pluripotent transcription factor belongs to homeobox family of protein required for the survival of primordial germ cell differentiation. Spermatogenesis is associated with highly specialized kind of germ cells (spermatocytes) to form mature single sperm that contribute to the formation of totipotent zygotes any defect in stem cells can lead to infertility. Since, Nanog is a regulatory factor hence the present study has been carried out to evaluate a novel role of Nanog in male infertility and their association with stem cell dysregulations. Blood samples were collected from the patients of azoospermic (absence of sperm) patients and genomic DNA was isolated subjected to PCR based analysis were carried out using specific forward 5’CTGTGATTTGTGGGCCTGA3’ forward and 5’TGTTTGCCTTTGGGACTGGT3’ reverse primers of Nanog3 gene. Interestingly, 8.33% cases revealed a complete disappearance (null) of 151bp length fragment of Nanog (deletion), while 25% overexpression (up regulation) when compared with the normal healthy fertile individuals act as controls. Present study concluded that “mutation” of Nanog3 interfere the process of spermatogenesis either in synergistic manner or with other stem cells (Oct4 or Sox) and increase “risk factor” in male infertility.